SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


6.12 kDa
protein length
gene length
174 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,565,715 2,565,888

    Expression and Regulation


    view in new tab

    Biological materials


  • BKE24800 ([gene|6D361C01C85ECBF35824D9D524A3C4D714103785|yqgW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACAGCCCCCTTTAC, downstream forward: _UP4_TAAAACCTGTATCCGATCGG
  • BKK24800 ([gene|6D361C01C85ECBF35824D9D524A3C4D714103785|yqgW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACAGCCCCCTTTAC, downstream forward: _UP4_TAAAACCTGTATCCGATCGG