SubtiBank SubtiBank
yqgW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgW

unknown
locus
BSU_24800
pI
11.41
mw
6.12 kDa
protein length
gene length
174 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,565,715 2,565,888

    Expression and Regulation

    Operons

    genes
    [gene|6D361C01C85ECBF35824D9D524A3C4D714103785|yqgW]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE24800 ([gene|6D361C01C85ECBF35824D9D524A3C4D714103785|yqgW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACAGCCCCCTTTAC, downstream forward: _UP4_TAAAACCTGTATCCGATCGG
  • BKK24800 ([gene|6D361C01C85ECBF35824D9D524A3C4D714103785|yqgW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACACAGCCCCCTTTAC, downstream forward: _UP4_TAAAACCTGTATCCGATCGG