SubtiBank SubtiBank
yxjM
The papers of the month are back! Check them out! Link here

yxjM

two-component sensor kinase
locus
BSU38900
pI
6.80
mw
45.07 kDa
protein length
406 aa Sequence Blast
gene length
1218 bp Sequence Blast
function
unknown
product
two-component sensor kinase (NarL family)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,993,162 → 3,994,382

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL]
  • Modification

  • autophosphorylation on a His residue
  • Biological materials

    Mutant

  • MGNA-B801 (yxjM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1800 NBRP B. subtilis, Japan]
  • BKE38900 (Δ[gene|6D10C9232F0D28973F7C3C6ECDFD6948928CB23F|yxjM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATGCTGGTCCTTCTTT, downstream forward: _UP4_ATGACAACGAATAAGGAGCA
  • BKK38900 (Δ[gene|6D10C9232F0D28973F7C3C6ECDFD6948928CB23F|yxjM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATGCTGGTCCTTCTTT, downstream forward: _UP4_ATGACAACGAATAAGGAGCA
  • References

  • 10094672