SubtiBank SubtiBank
atpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpE

ATP synthase, part of the Fo complex (subunit c)
locus
BSU_36860
pI
6.43
mw
6.96 kDa
protein length
gene length
213 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit c)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,786,620 3,786,832

    The protein

    Catalyzed reaction/ biological activity

  • ATP synthesis [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • ATPase C chain family (single member, according to UniProt)
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|1WU0] (from ''Bacillus sp.'', 73% identity)
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE36860 ([gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAAGTTCCTCCTTT, downstream forward: _UP4_TAAGCATAAAAGCCTTATAT
  • BKK36860 ([gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAAGTTCCTCCTTT, downstream forward: _UP4_TAAGCATAAAAGCCTTATAT
  • References

    Reviews

  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,18763711,29610201,30580998