SubtiBank SubtiBank
sat
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sat

sulfate adenylyltransferase
locus
BSU_15590
pI
5.65
mw
42.73 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
sulfate activation
product
sulfate adenylyltransferase
essential
no
ec
2.7.7.4
synonyms
ylnB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    1,632,208 1,633,356

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H+ + sulfate --> adenosine 5'-phosphosulfate + diphosphate (according to UniProt)
  • Protein family

  • sulfate adenylyltransferase family (with [protein|EBBA4432FF83B6F203C694E04111D45290BE157A|YitA], according to UniProt)
  • Paralogous protein(s)

  • [protein|EBBA4432FF83B6F203C694E04111D45290BE157A|YitA]
  • Structure

  • [PDB|1V47] (from ''Thermus thermophilus'', 42% identity) [Pubmed|15065853]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B366 (ylnB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1365 NBRP B. subtilis, Japan]
  • BKE15590 ([gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCATCTCCTCCT, downstream forward: _UP4_GGCGTATCTTAAGGAGGACT
  • BKK15590 ([gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATCCATCTCCTCCT, downstream forward: _UP4_GGCGTATCTTAAGGAGGACT
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 16267287,11004190,12107147,18039762,15378759,15065853