SubtiBank SubtiBank
glnM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glnM

glutamine [SW|ABC transporter] (membrane protein)
locus
BSU27450
pI
8.42
mw
23.55 kDa
protein length
216 aa Sequence Blast
gene length
651 bp Sequence Blast
function
glutamine uptake
product
glutamine [SW|ABC transporter] (membrane protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,803,990 2,804,640

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CD32011A08697B2C121996A02F1BD7BE4F932778|GlnP]
  • Structure

  • [PDB|4YMS] (complex with [protein|CD32011A08697B2C121996A02F1BD7BE4F932778|GlnP]; from ''Thermoanaerobacter tengcongensis '', 40% identity) [Pubmed|25848002]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|glnQ]-[gene|BAB70547672C855AEB3A4D4624044340CF582848|glnH]-[gene|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|glnM]-[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE27450 ([gene|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|glnM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTATTCACTCCTT, downstream forward: _UP4_AGCTATTGATAAGGAGTGAG
  • BKK27450 ([gene|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|glnM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTATTCACTCCTT, downstream forward: _UP4_AGCTATTGATAAGGAGTGAG
  • References

  • 10092453,25755103,12823818,15699190,25848002,20023025