SubtiBank SubtiBank
yhgB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhgB

unknown
locus
BSU_10090
pI
9.95
mw
11.86 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yixB

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,082,870 1,083,184

    Biological materials

    Mutant

  • MGNA-B502 (yhgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1501 NBRP B. subtilis, Japan]
  • BKE10090 ([gene|6CE4CF4C1078417EB33402426C0B0681D5ED9678|yhgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGCTTTCCTCCCAAT, downstream forward: _UP4_TAACCCTCCCCTCTGTCCCG
  • BKK10090 ([gene|6CE4CF4C1078417EB33402426C0B0681D5ED9678|yhgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGCTTTCCTCCCAAT, downstream forward: _UP4_TAACCCTCCCCTCTGTCCCG
  • References

  • 27766092