SubtiBank SubtiBank
yrzS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrzS

unknown
locus
BSU_27729
pI
9.87
mw
7.30 kDa
protein length
gene length
201 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,834,957 2,835,157

    Expression and Regulation

    Operons

    genes
    [gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]-[gene|6CDF1836F5B613A6718308A4A27D713193EA197B|yrzS]-[gene|23174B2A19DEDF2F20858A005D0681D36E15E6E3|queA]-[gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt]-[gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF]
    description
    [pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt] and [gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE27729 ([gene|6CDF1836F5B613A6718308A4A27D713193EA197B|yrzS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27729 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCATAATGATCTTAG, downstream forward: _UP4_TAACAAAAGACTAGAATAAA
  • BKK27729 ([gene|6CDF1836F5B613A6718308A4A27D713193EA197B|yrzS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27729 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGAATCATAATGATCTTAG, downstream forward: _UP4_TAACAAAAGACTAGAATAAA