SubtiBank SubtiBank
sprA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sprA

DNA recombinase, serine-type integrase, [SW|SP-beta prophage] site-specific recombination factor A
locus
BSU_21660
pI
8.95
mw
62.96 kDa
protein length
545 aa Sequence Blast
gene length
1638 bp Sequence Blast
function
excision of the [SW|SP-beta prophage]
product
[SW|SP-beta prophage] site-specific recombination factor A
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.1|Excision of prophages]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,284,771 2,286,408

    The protein

    Protein family

  • N-terminal part: [SW|site-specific recombinase resolvase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Resolvase/invertase-type recombinase catalytic domain] (aa 14-165) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6CBEACD5C9C88319C4F9BE4C53F5C6534EF9135F|sprA]-[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]

    description

  • [pubmed|22383849]
  • sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE21660 ([gene|6CBEACD5C9C88319C4F9BE4C53F5C6534EF9135F|sprA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATTTAGCACCTCTTT, downstream forward: _UP4_TAAGAAAAGTAGTAAGTATC
  • BKK21660 ([gene|6CBEACD5C9C88319C4F9BE4C53F5C6534EF9135F|sprA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATTTAGCACCTCTTT, downstream forward: _UP4_TAAGAAAAGTAGTAAGTATC
  • References

  • 25299644,28535266