SubtiBank SubtiBank
spoIISB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIISB

disruption blocks sporulation after septum formation
locus
BSU_12820
pI
10.79
mw
6.52 kDa
protein length
gene length
171 bp Sequence Blast
function
sporulation
product
anti-toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • Gene

    Coordinates
    1,348,442 1,348,612

    Phenotypes of a mutant

  • sporulation efficiency is reduced by four orders of magnitude [Pubmed|11371520]
  • The protein

    Protein family

  • SpoIISB antitoxin family (single member, according to UniProt)
  • Structure

  • [PDB|3O6Q] (cytoplasmic fragment of [protein|CD14C88E9976964A0D25BAA22C395A5A6951654D|SpoIISA] (CSpoIISA) in complex with [protein|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|SpoIISB]) [Pubmed|21147767]
  • Expression and Regulation

    Operons

    genes
    [gene|CD14C88E9976964A0D25BAA22C395A5A6951654D|spoIISA]-[gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]
    description
    [Pubmed|11371520]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1S124 ( ''spoIISB''::''tet''), [Pubmed|11371520], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S124&Search=1S124 BGSC]
  • BKE12820 ([gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTTTTGAAACGCACGTT, downstream forward: _UP4_TGATCACACTAAAAGGACAA
  • BKK12820 ([gene|6C9F403D67CDC2EE66C534B0F23D973E24C9A089|spoIISB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTTTTGAAACGCACGTT, downstream forward: _UP4_TGATCACACTAAAAGGACAA
  • References

  • 18096016,11371520,26300872,21147767,27294956