SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, antagonist of biofilm repression by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR], control of the [SW|phosphorelay]
16.77 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity, see [SW|Targets of the Y complex]
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Effectors of RNA degradation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • Gene

    1,568,420 1,568,869

    Phenotypes of a mutant

  • strongly reduced [SW|genetic competence], strongly reduced [SW|sporulation] [Pubmed|23490197]
  • defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • The protein

    Catalyzed reaction/ biological activity

  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation in the [category|SW 4.2.2|phosphorelay] [pubmed|27501195]
  • [SW|Cofactors]

  • one 4Fe-4S cluster (contributes to the co-ordination of the cluster (with [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA] and [protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT])) [pubmed|31530674]
  • Structure

  • [PDB|6PRK] (the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF] complex) [pubmed|31530674]
  • [SW|Localization]

  • cytoplasm [pubmed|27501195]
  • Expression and Regulation


    view in new tab

    view in new tab

    additional information

  • 7,000/ 340 molecules per cell during growth in LB/ minimal medium [pubmed|31530674]
  • Biological materials


  • BKE14990 ([gene|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATAACATGCACCTCCAGTT, downstream forward: _UP4_TGACGAGACTGGCCGTCTCG
  • BKK14990 ([gene|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATGCACCTCCAGTT, downstream forward: _UP4_TGACGAGACTGGCCGTCTCG
  • References


  • 32061882,32156829,32156813
  • Original publications

  • 10712692,15661000,23490197,15175311,26434553,28295778,27501195,29794222,31530674