SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


blue light sensor, positive regulation of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity under conditions of blue light
29.04 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
blue light receptor, flavoprotein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • Gene

    3,106,210 3,106,995

    The protein

    Catalyzed reaction/ biological activity

  • mediates light-dependent stimulation of [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] kinase activity [Pubmed|23416074]
  • Paralogous protein(s)

  • [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC], [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]
  • [SW|Domains]

  • [SW|PAS domain] (aa 12-87) (according to UniProt)
  • [SW|PAC domain] (aa 88-138) (according to UniProt)
  • [SW|STAS domain] (aa 147-258) (according to UniProt)
  • [SW|Cofactors]

  • FMN
  • Effectors of protein activity

  • [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]-dependent light activation of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] stress response is positively and negatively regulated by [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] and [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], respectively [Pubmed|22287516]
  • Structure

  • [PDB|2PR5] (dark), [PDB|2PR6] (light), [PDB|2MWG]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16923906], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials


  • MGNA-A136 (ytvA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A965 ( ''ytvA''::''erm''), [Pubmed|11157946], available at [ BGSC]
  • BKE30340 ([gene|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAATCCCCCTTAGGC, downstream forward: _UP4_TAAAAAGATCCCGCTCACCC
  • BKK30340 ([gene|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAATCCCCCTTAGGC, downstream forward: _UP4_TAAAAAGATCCCGCTCACCC
  • Expression vectors

  • pGP2685, expression of His-[protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA] in ''E. coli'' (based on [SW|pGP570]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Chet Price], Davis, USA [ homepage]
  • References


  • 18400553,21822294,26189730,28271471
  • Original publications

  • 27203230,19581299,16923906,17575448,17764689,17443319,17200735,16923909,16797012,16022561,15339223,11964249,11157946,19891470,20062844,19783626,20800068,22247770,23047813,23416074,23456923,23817467,21259411,21388385,21410163,21851109,22287516,23861663,23828427,23900620,23940057,24171435,24278408,25211155,26402155