SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to amino acid ABC transporter (membrane protein)
27.27 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
ABC transporter (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,294,996 1,295,748

    The protein

    Protein family

  • UPF0014 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A363 (yjkA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12240 ([gene|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|yjkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAGAGAGAGAAAGGTAAT, downstream forward: _UP4_TGACAGACAAAAGCCGCTTT
  • BKK12240 ([gene|6C432E77C5A6F9955DDF4F7BE3FFD55C30BB812A|yjkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAGAGAGAGAAAGGTAAT, downstream forward: _UP4_TGACAGACAAAAGCCGCTTT
  • References

  • 10092453