SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


12.85 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,065,042 2,065,377

    Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • MGNA-B410 (yozM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18960 ([gene|6C3261E009BA8A386055323CA24DFE9D7AF76AE6|yozM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCATCACACTCTCC, downstream forward: _UP4_TAAAACGCCCAGCAATTAAA
  • BKK18960 ([gene|6C3261E009BA8A386055323CA24DFE9D7AF76AE6|yozM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCATCACACTCTCC, downstream forward: _UP4_TAAAACGCCCAGCAATTAAA
  • References

  • 16267290,12850135