SubtiBank SubtiBank
yozM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozM

unknown
locus
BSU_18960
pI
5.35
mw
12.85 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,065,042 2,065,377

    Expression and Regulation

    Operons

    genes
    [gene|6C3261E009BA8A386055323CA24DFE9D7AF76AE6|yozM]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B410 (yozM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1409 NBRP B. subtilis, Japan]
  • BKE18960 ([gene|6C3261E009BA8A386055323CA24DFE9D7AF76AE6|yozM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCATCACACTCTCC, downstream forward: _UP4_TAAAACGCCCAGCAATTAAA
  • BKK18960 ([gene|6C3261E009BA8A386055323CA24DFE9D7AF76AE6|yozM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCATCACACTCTCC, downstream forward: _UP4_TAAAACGCCCAGCAATTAAA
  • References

  • 16267290,12850135