SubtiBank SubtiBank
ylaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylaA

unknown
locus
BSU_14710
pI
6.75
mw
74.74 kDa
protein length
646 aa Sequence Blast
gene length
1941 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,541,886 1,543,826

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16501307], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]: sigma factor, [Pubmed|16501307], in [regulon|544344B61A804F367BB726976E0C87B61998490A|YlaC regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16501307], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A534 (ylaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/534 NBRP B. subtilis, Japan]
  • BKE14710 ([gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTTTACTTCTTATTA, downstream forward: _UP4_GAAACACAAGAGGTGAAAAG
  • BKK14710 ([gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTTTACTTCTTATTA, downstream forward: _UP4_GAAACACAAGAGGTGAAAAG
  • References

  • 16501307