SubtiBank SubtiBank
bpsB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bpsB

methyltransferase, involved in polyketide synthesis
locus
BSU22040
pI
9.55
mw
19.17 kDa
protein length
168 aa Sequence Blast
gene length
507 bp Sequence Blast
function
polyketide synthesis
product
methyltransferase
essential
no
synonyms
ypbQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    2,316,446 2,316,952

    The protein

    Catalyzed reaction/ biological activity

  • conversion of triketide pyrones to alkylpyrone methyl ethers [Pubmed|19465653]
  • Expression and Regulation

    Operons

    genes
    [gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]-[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]
    description
    [Pubmed|19465653]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A876 (ypbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/876 NBRP B. subtilis, Japan]
  • BKE22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA, downstream forward: _UP4_TAGCGATTGAAAATCATTCT
  • BKK22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA, downstream forward: _UP4_TAGCGATTGAAAATCATTCT
  • References

  • 19465653,20525796