SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


methyltransferase, involved in polyketide synthesis
19.17 kDa
protein length
168 aa Sequence Blast
gene length
507 bp Sequence Blast
polyketide synthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    2,316,446 2,316,952

    The protein

    Catalyzed reaction/ biological activity

  • conversion of triketide pyrones to alkylpyrone methyl ethers [Pubmed|19465653]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A876 (ypbQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA, downstream forward: _UP4_TAGCGATTGAAAATCATTCT
  • BKK22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA, downstream forward: _UP4_TAGCGATTGAAAATCATTCT
  • References

  • 19465653,20525796