SubtiBank SubtiBank
bpsB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bpsB

methyltransferase, involved in polyketide synthesis
locus
BSU_22040
pI
9.55
mw
19.17 kDa
protein length
168 aa Sequence Blast
gene length
507 bp Sequence Blast
function
polyketide synthesis
product
methyltransferase
essential
no
synonyms
ypbQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    2,316,446 2,316,952

    The protein

    Catalyzed reaction/ biological activity

  • conversion of triketide pyrones to alkylpyrone methyl ethers [Pubmed|19465653]
  • Expression and Regulation

    Operons

    genes
    [gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]-[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]
    description
    [Pubmed|19465653]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A876 (ypbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/876 NBRP B. subtilis, Japan]
  • BKE22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA, downstream forward: _UP4_TAGCGATTGAAAATCATTCT
  • BKK22040 ([gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCGATCAACAACCAAAACA, downstream forward: _UP4_TAGCGATTGAAAATCATTCT
  • References

  • 19465653,20525796