SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


part of the ydzS pseudogene
0.00 kDa
protein length
gene length
102 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    581,228 581,329

    Expression and Regulation



    regulatory mechanism

  • [protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]: repression, [Pubmed|15948947], in [regulon|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR regulon]
  • regulation

  • induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]) [Pubmed|15948947]
  • view in new tab

    Biological materials


  • BKE05343 ([gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATTGTTTTCCTTGATATA, downstream forward: _UP4_GAAGCTCAAGGATGACATCG
  • BKK05343 ([gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATTGTTTTCCTTGATATA, downstream forward: _UP4_GAAGCTCAAGGATGACATCG