SubtiBank SubtiBank
yoxD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoxD

similar to 3-oxoacyl- acyl-carrier protein reductase
locus
BSU_18500
pI
5.33
mw
25.15 kDa
protein length
238 aa Sequence Blast
gene length
717 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,018,554 2,019,270

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF], [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF], [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG]
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|2C07] (from Plasmodium Falciparum 37% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|yoxD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B094 (yoxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1093 NBRP B. subtilis, Japan]
  • BKE18500 ([gene|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|yoxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAGCACCCTTTCTT, downstream forward: _UP4_TAAAAATGAAAACCTGTCTT
  • BKK18500 ([gene|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|yoxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAGCACCCTTTCTT, downstream forward: _UP4_TAAAAATGAAAACCTGTCTT
  • References

  • 16493705