SubtiBank SubtiBank
ydjN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydjN

unknown
locus
BSU_06260
pI
7.35
mw
39.55 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    679,827 680,873

    The protein

    [SW|Localization]

  • secreted (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|18ED48E99D87748B2EBD6001EFDF1D3D91535ABF|ydjM]-[gene|6B93DA610D4D86A5D4E53190999FB0E4E10AE8E5|ydjN]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [pubmed|20059685], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • activated by [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] [Pubmed|17581128]
  • additional information

  • the terminator is [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]-dependent [ http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C221 (ydjN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2219 NBRP B. subtilis, Japan]
  • BKE06260 ([gene|6B93DA610D4D86A5D4E53190999FB0E4E10AE8E5|ydjN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTATCTCCACCAAT, downstream forward: _UP4_TAATAAAAACCACTCGGCAT
  • BKK06260 ([gene|6B93DA610D4D86A5D4E53190999FB0E4E10AE8E5|ydjN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTATCTCCACCAAT, downstream forward: _UP4_TAATAAAAACCACTCGGCAT