SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


39.55 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    679,827 680,873

    The protein


  • secreted (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [pubmed|17581128], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [pubmed|20059685], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • activated by [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR] [Pubmed|17581128]
  • additional information

  • the terminator is [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]-dependent [ Reference]
  • view in new tab

    Biological materials


  • MGNA-C221 (ydjN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06260 ([gene|6B93DA610D4D86A5D4E53190999FB0E4E10AE8E5|ydjN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTATCTCCACCAAT, downstream forward: _UP4_TAATAAAAACCACTCGGCAT
  • BKK06260 ([gene|6B93DA610D4D86A5D4E53190999FB0E4E10AE8E5|ydjN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTATCTCCACCAAT, downstream forward: _UP4_TAATAAAAACCACTCGGCAT