SubtiBank SubtiBank
yqbH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbH

similar to phage-related protein
locus
BSU26110
pI
6.22
mw
14.13 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,682,127 2,682,489

    The protein

    Paralogous protein(s)

  • [protein|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|XkdH]
  • Structure

  • [PDB|3F3B] ([protein|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|XkdH], 53% identity)
  • Biological materials

    Mutant

  • BKE26110 ([gene|6B81CDCA07B62D6A91B126F2CABC2F5C839689E4|yqbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAGTCAATAAGGATTGAT, downstream forward: _UP4_GCAGTACGGGAGGTTGAATA
  • BKK26110 ([gene|6B81CDCA07B62D6A91B126F2CABC2F5C839689E4|yqbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAGTCAATAAGGATTGAT, downstream forward: _UP4_GCAGTACGGGAGGTTGAATA