SubtiBank SubtiBank
yqbH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbH

similar to phage-related protein
locus
BSU_26110
pI
6.22
mw
14.13 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,682,127 2,682,489

    The protein

    Paralogous protein(s)

  • [protein|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|XkdH]
  • Structure

  • [PDB|3F3B] ([protein|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|XkdH], 53% identity)
  • Biological materials

    Mutant

  • BKE26110 ([gene|6B81CDCA07B62D6A91B126F2CABC2F5C839689E4|yqbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAGTCAATAAGGATTGAT, downstream forward: _UP4_GCAGTACGGGAGGTTGAATA
  • BKK26110 ([gene|6B81CDCA07B62D6A91B126F2CABC2F5C839689E4|yqbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAGTCAATAAGGATTGAT, downstream forward: _UP4_GCAGTACGGGAGGTTGAATA