SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to phage-related protein
14.13 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,682,127 2,682,489

    The protein

    Paralogous protein(s)

  • [protein|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|XkdH]
  • Structure

  • [PDB|3F3B] ([protein|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|XkdH], 53% identity)
  • Biological materials


  • BKE26110 ([gene|6B81CDCA07B62D6A91B126F2CABC2F5C839689E4|yqbH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAGTCAATAAGGATTGAT, downstream forward: _UP4_GCAGTACGGGAGGTTGAATA
  • BKK26110 ([gene|6B81CDCA07B62D6A91B126F2CABC2F5C839689E4|yqbH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGAGTCAATAAGGATTGAT, downstream forward: _UP4_GCAGTACGGGAGGTTGAATA