SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component sensor kinase, chemotactic signal modulator
74.59 kDa
protein length
672 aa Sequence Blast
gene length
2019 bp Sequence Blast
chemotactic signal modulator
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Soluble signalling proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,712,815 1,714,833

    Phenotypes of a mutant

  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY] and [protein|B0415A8CD040EC714B54F4038E065B3E1E20A271|CheB] [Pubmed|11553614]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • HPt domain (aa 1-103) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 290-540) (according to UniProt)
  • CheW-like domain (aa 542-672) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • phosphorylation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] is stimulated by interaction with the complex of deaminated [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC]-[protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD] [Pubmed|22931217]
  • the kinase activity of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] is activated by chemoreceptors bound to [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD] [Pubmed|23226535]
  • Structure

  • [PDB|6S1K] (from E. coli, 35% identity) [pubmed|31925330]
  • [SW|Localization]

  • membrane (according to UniProt)
  • localizes to the cell poles [Pubmed|21098025]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    additional information

  • in minimal medium, CheA is present with 2,600 +/- 560 molecules per cell [PubMed|21515776]
  • Biological materials


  • 1A797 ( ''cheA''::''cat''), [Pubmed|1938941], available at [ BGSC]
  • DS6887 (marker-less in NCIB3610) [Pubmed|25313396]
  • BKE16430 ([gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACTGATTCATATCCATTT, downstream forward: _UP4_TAACCATTCGAGGAGGTGTC
  • BKK16430 ([gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATACTGATTCATATCCATTT, downstream forward: _UP4_TAACCATTCGAGGAGGTGTC
  • labs

  • [SW|Daniel Kearns]
  • References


  • 20122866
  • Original publications

  • 26122431,25313396,1938941,12123464,17908686,8866475,12094812,10094672,11722727,14651647,9657996,8157612,15175317,9721285,17850253,11553614,21098025,22931217,21515776,23226535,24386445,25039821,31925330