SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to immunity to bacteriotoxins
36.25 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    2,088,257 2,089,234

    The protein

    Protein family

  • peptidase S66 family (with [protein|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|YkfA], according to UniProt)
  • Structure

  • [PDB|3SR3] (MccF from ''B. anthracis'', 33% identity, 66% similarity)
  • Expression and Regulation


    view in new tab


    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-B413 (yocD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19170 ([gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCCTCCATCAATG, downstream forward: _UP4_TAATCAGCTTGTAAATTTTT
  • BKK19170 ([gene|6B36C3B0FA04FBCB20C2C9AEA987DDD211E29629|yocD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCCTCCATCAATG, downstream forward: _UP4_TAATCAGCTTGTAAATTTTT
  • References

  • 20817675