SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phage-derived sublancin S-glycosyltransferase
49.60 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
biosynthesis of the antimicrobial peptide sublancin
sublancin S-glycosyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,265,668 2,266,936

    The protein

    Catalyzed reaction/ biological activity

  • selectively modifies Cys22 in a 56-amino acid peptide substrate [protein|1A6D90298D039FFFD977B2534952BA5E32B3530F|SunA] and can accept a variety of NDP-sugars [Pubmed|21196935]
  • Protein family

  • [SW|glycosyltransferase 2 family] (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|20817675,19465659], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • expression starts in the stationary phase [pubmed|30808982]
  • expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [pubmed|30808982]
  • additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • BKE21450 ([gene|6B2DC9873B7B693D9D0FC0D773740140D0640C9E|yolJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTATCACCATTTTT, downstream forward: _UP4_GTATGAATACAAGATATGTA
  • BKK21450 ([gene|6B2DC9873B7B693D9D0FC0D773740140D0640C9E|yolJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTATCACCATTTTT, downstream forward: _UP4_GTATGAATACAAGATATGTA
  • References

  • 27902860,15743949,21196935,20817675,21910430,21815947