SubtiBank SubtiBank
ydeR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydeR

similar to antibiotic resistance protein
locus
BSU_05310
pI
10.76
mw
40.99 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    576,946 578,133

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C139 (ydeR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2137 NBRP B. subtilis, Japan]
  • BKE05310 ([gene|6B11EE4269A2CFF8A37C63FA41EA6BAD2727D0A4|ydeR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATGAACTCCTTTT, downstream forward: _UP4_TAAGTATTTCACCAAAAATA
  • BKK05310 ([gene|6B11EE4269A2CFF8A37C63FA41EA6BAD2727D0A4|ydeR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAATGAACTCCTTTT, downstream forward: _UP4_TAAGTATTTCACCAAAAATA