SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore maturation protein (spore core dehydratation)
18.91 kDa
protein length
179 aa Sequence Blast
gene length
537 bp Sequence Blast
spore maturation protein (spore core dehydratation)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,422,264 → 2,422,800

    The protein

    Protein family

  • spmB family (single member, according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,7528199], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,7528199]
  • view in new tab

    Biological materials


  • MGNA-A003 (spmB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23170 (Δ[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCCAGTTGATGATTTCCA, downstream forward: _UP4_TGAAAACGGCGTTTTTTTTA
  • BKK23170 (Δ[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCCAGTTGATGATTTCCA, downstream forward: _UP4_TGAAAACGGCGTTTTTTTTA
  • References

  • 7642500,7528199,15699190