SubtiBank SubtiBank
spmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spmB

spore maturation protein (spore core dehydratation)
locus
BSU_23170
pI
5.50
mw
18.91 kDa
protein length
179 aa Sequence Blast
gene length
537 bp Sequence Blast
function
germination
product
spore maturation protein (spore core dehydratation)
essential
no
synonyms
ypuK

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,422,264 → 2,422,800

    The protein

    Protein family

  • spmB family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]-[gene|F00DAFFBB136F9331C47D45BF44DC59E3EBB75FA|spmA]-[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]
    description
    [Pubmed|7642500]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,7528199], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,7528199]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A003 (spmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/3 NBRP B. subtilis, Japan]
  • BKE23170 (Δ[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCCAGTTGATGATTTCCA, downstream forward: _UP4_TGAAAACGGCGTTTTTTTTA
  • BKK23170 (Δ[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCCAGTTGATGATTTCCA, downstream forward: _UP4_TGAAAACGGCGTTTTTTTTA
  • References

  • 7642500,7528199,15699190