SubtiBank SubtiBank
remA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

remA

transcriptional regulator of the extracellular matrix genes, acts in parallel to SinR, AbrB, and DegU
locus
BSU_15670
pI
7.18
mw
9.71 kDa
protein length
gene length
270 bp Sequence Blast
function
control of biofilm formation
product
regulator of the extracellular matrix genes
essential
no
synonyms
ylzA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    1,641,672 1,641,941

    The protein

    Catalyzed reaction/ biological activity

  • binds opuAA, tapA, and epsA promoter regions (upstream of the actual promoter) to activate transcription [Pubmed|23646920]
  • binds DNA with high co-operativity due to low conserrvation of binding sites [Pubmed|23646920]
  • Protein family

  • RemA family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|23396918], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during vegetative growth and early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|23396918]
  • view in new tab

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

    description

  • [pubmed|22383849]
  • view in new tab

    genes
    [gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]-[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • regulation

  • expressed during sporulation in the mother cell [pubmed|12161109]
  • view in new tab

    Biological materials

    Mutant

  • BKE15670 ([gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTACGTTCCCCCTG, downstream forward: _UP4_GATGAAGGGCAGGGGTAATT
  • BKK15670 ([gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTACGTTCCCCCTG, downstream forward: _UP4_GATGAAGGGCAGGGGTAATT
  • labs

  • [SW|Daniel Kearns], Indiana University, Bloomington, USA, [http://www.bio.indiana.edu/facultyresearch/faculty/Kearns.html homepage]
  • References

    Reviews

  • 24988880
  • Original publications

  • 19363116,22329926,23123912,23396918,23646920,25035996