SubtiBank SubtiBank
yqeV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeV

tRNA methylthiotransferase
locus
BSU25430
pI
5.24
mw
51.49 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
tRNA maturation
product
tRNA methylthiotransferase
essential
no
synonyms
yqeV

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    2,621,677 2,623,032

    The protein

    Catalyzed reaction/ biological activity

  • modification of N(6)-threonylcarbamoyladenosine (t(6)A) to 2-methylthio-N(6)-threonylcarbamoyladenosine (ms(2)t(6)A) in tRNA [Pubmed|27913733,20472640]
  • Protein family

  • YqeV subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|YmcB]
  • [SW|Cofactors]

  • 2 Fe-S clusters [Pubmed|20584901]
  • Structure

  • [PDB|4JC0] (from ''Thermotoga maritima'', 29% identity) [Pubmed|23542644]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C496 (yqeV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2494 NBRP B. subtilis, Japan]
  • BKE25430 ([gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTATGGAAAGCAACAGTTG, downstream forward: _UP4_TAACCTAAAAAATCGGTGCA
  • BKK25430 ([gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTATGGAAAGCAACAGTTG, downstream forward: _UP4_TAACCTAAAAAATCGGTGCA
  • References

  • 10383760,9023197,7592421,20472640,20584901,27913733,23542644