SubtiBank SubtiBank
yrzM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrzM

unknown, putative pseudogene
locus
BSU_26558
pI
0.00
mw
0.00 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,714,231 2,714,548

    Expression and Regulation

    Operons

    genes
    [gene|6AD1DD074B2F044C6A4E4B98FABC4E7FD67B3139|yrzM]-[gene|8A3F1BFDF85DD96B7FB4EBC807F71639AF69DE98|yrkD]-[gene|1F1FE531622CD218EE8990CDAC6D2D2F9E86FE3F|yrkE]-[gene|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|yrkF]-[gene|06CC915A18E5ADD42B784B7BBBFD4C344559A34E|yrkH]-[gene|D996F581E21395C3F9CC064800C49A765EFC17A7|yrkI]-[gene|F3E842844B315FE438F66995CDFB8BA1C32BDF23|yrkJ]-[gene|1BEBD09273240B6B50DABCB160FCCBC205BB2AAE|yrkK]-[gene|search|yrkM]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|6AD1DD074B2F044C6A4E4B98FABC4E7FD67B3139|yrzM]-[gene|8A3F1BFDF85DD96B7FB4EBC807F71639AF69DE98|yrkD]-[gene|1F1FE531622CD218EE8990CDAC6D2D2F9E86FE3F|yrkE]-[gene|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|yrkF]-[gene|06CC915A18E5ADD42B784B7BBBFD4C344559A34E|yrkH]-[gene|D996F581E21395C3F9CC064800C49A765EFC17A7|yrkI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26558 ([gene|6AD1DD074B2F044C6A4E4B98FABC4E7FD67B3139|yrzM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26558 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAATAAGCAGGAATG, downstream forward: _UP4_TGAAAGAAAGGATTTCATTG
  • BKK26558 ([gene|6AD1DD074B2F044C6A4E4B98FABC4E7FD67B3139|yrzM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26558 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAATAAGCAGGAATG, downstream forward: _UP4_TGAAAGAAAGGATTTCATTG