pycA

pyruvate carboxylase

locus: BSU_14860

pI: 5.41

mw: 127.72 kDa

protein length: 1148 aa

gene length: 3447 bp

function: replenishment of the oxaloacetate pool

product: pyruvate carboxylase

essential: no

synonyms: ylaP

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,554,185 1,557,631

The protein

Catalyzed reaction/ biological activity

• ATP + hydrogencarbonate + pyruvate --> ADP + H⁺ + oxaloacetate + phosphate (according to UniProt)

[SW|Domains]

• [SW|ATP-grasp doamin] (aa 125-321) (according to UniProt)
• Biotin carboxylation domain (aa 1-457) (according to UniProt)
• Pyruvate carboxyltransferase domain (aa 534-802) (according to UniProt)
• Biotinyl-binding domain (aa 1071-1146) (according to UniProt)

[SW|Cofactors]

• biotin [Pubmed|24816803]

Structure

• [PDB|3BG5] (''S. aureus'') [pubmed|18297087]

[SW|Localization]

• membrane associated [Pubmed|18763711]
• cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]

Additional information

• PycA binds to StrepTactin, and may be co-purified when purifying Strep-tagged proteins by [SW|SPINE].
• PycA is subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]

Expression and Regulation

Operons

• genes: [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW]-[gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]
  description: [pubmed|22383849]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [protein|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|YofA]: activation, [Pubmed|17526699], in [regulon|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|YofA regulon]
  • [regulon|stringent response|stringent response]: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]

  regulation

  • constitutively expressed [Pubmed|23701187]

• genes: [gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]
  description: [Pubmed|20081037]

  regulation

  • subject to positive stringent control upon lysine starvation [Pubmed|20081037]

Biological materials

Mutant

• MGNA-A544 (ylaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/544 NBRP B. subtilis, Japan]
• GP793 (cat), available in [SW|Jörg Stülke]'s lab
• BKE14860 ([gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC, downstream forward: _UP4_TAAAAAACAAAGAGTGTATA
• BKK14860 ([gene|6ABF79C6EEF078E4F71F569FACCA80DA67191AE2|pycA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTTTTCTCCCCCTTAC, downstream forward: _UP4_TAAAAAACAAAGAGTGTATA

Expression vectors

• pGP1289 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab

References

Reviews

• 18613815,12769720,10229653,9597748,7780827,28271481

Original publications

• 18763711,20081037,24825009,25755103,24816803,18297087