SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


checkpoint protein for [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] expression, [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] anatagonist
16.03 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
control of [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] activity
flagellar assembly factor, [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] anatagonist

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    3,636,264 3,636,695

    The protein

    Catalyzed reaction/ biological activity

  • [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] binds [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] when [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|Hag] is secreted after hook completion (and [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] released from the [protein|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|Hag]-[protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] complex) to allow translation of the'' [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mRNA [Pubmed|21895793]
  • Protein family

  • fliW family (according to Swiss-Prot)
  • Structure

  • [PDB|5DMD] (from ''Geobacillus thermodenitrificans'') [Pubmed|27551070]
  • [PDB|5DMB] ([protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW]-[protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] complex) [Pubmed|27551070]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] and [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] form a conserved module in many bacteria [Pubmed|21895793,27516547]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    Biological materials


  • MGNA-A339 (yviF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35380 ([gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACGATCCTTTTC, downstream forward: _UP4_AAGCATCCGATTGGAGGAGA
  • BKK35380 ([gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACGATCCTTTTC, downstream forward: _UP4_AAGCATCCGATTGGAGGAGA
  • References


  • 22672726,25251856
  • Original Publications

  • 16936039,23144244,21895793,26577401,27516547,27551070,31113895