SubtiBank SubtiBank
qdoI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

qdoI

Fe-containing quercetin 2,3-dioxygenase
locus
BSU_39980
pI
5.56
mw
37.43 kDa
protein length
337 aa Sequence Blast
gene length
1014 bp Sequence Blast
function
resistance to plant product quercetin
product
Fe-containing quercetin 2,3-dioxygenase
essential
no
synonyms
yxaG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    4,106,245 4,107,258

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of the flavonol quercetin with dioxygen, cleaving the central heterocyclic ring and releasing CO
  • O2 + quercetin --> 2-(3,4-dihydroxybenzoyloxy)-4,6-dihydroxybenzoate + CO (according to UniProt)
  • Protein family

  • bicupin family
  • [SW|Domains]

  • 2 [SW|cupin 2 domain]s (aa 55 ... 110, aa 226 ... 281)
  • [SW|Cofactors]

  • Mn(II) (preferred), but also active with Fe(II) snd Co(II) [Pubmed|22084064]
  • Structure

  • [PDB|1Y3T] [Pubmed|15628860]
  • [PDB|2H0V]
  • Expression and Regulation

    Operons

    genes
    [gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]-[gene|142444E1167BA7428EB95E4418C839ADF3E728B0|yxaH]
    description
    [Pubmed|10746760]

    regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • [protein|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR]: repression, [Pubmed|17483215], in [regulon|47387014B5E89BF218BA94D8C2A570479B1EFD4E|QdoR regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|QdoR], [protein|search|LmrA]) [Pubmed|17483215]
  • additional information

  • major regulator: [protein|search|QdoR] [PubMed|17483215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B684 (yxaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1683 NBRP B. subtilis, Japan]
  • BKE39980 ([gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCGCTTCCTCCAA, downstream forward: _UP4_TAAAGATGACAAGATTGTAA
  • BKK39980 ([gene|6A68EF7BF16FC2F2C7E068F52901EF2BFD6EBF8A|qdoI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCGCTTCCTCCAA, downstream forward: _UP4_TAAAGATGACAAGATTGTAA
  • References

    Reviews

  • 9056848,10730195
  • Original publications

  • 17483215,14741339,15039076,15317768,10746760,20460727,14697267,22084064,16411777,27170159,15628860