SubtiBank SubtiBank
mgsR [2020-04-04 15:03:30]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mgsR [2020-04-04 15:03:30]

transcriptional regulator of a subset of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] general stress regulon, required for protection against oxidative stress
14.68 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
controls a subset of general stress genes
transcriptional regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,564,026 2,564,406

    The protein

    Catalyzed reaction/ biological activity

  • exerts a positive or negative effect on the expression of 53 or 18 stress genes, respectively [Pubmed|18643936]
  • Protein family

  • ArsC family (with [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and [protein|5278DD377B110CC14E239B9428F1985B472EEDF5|YusI], according to UniProt)
  • Paralogous protein(s)

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]
  • Modification

  • [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] is subject to post-translational redox-sensitive activation by intramolecular disulfide bond formation in response to ethanol stress [Pubmed|22812682]
  • Structure

  • [PDB|3L78] (from Streptococcus mutans, 42% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|18643936], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR]: activation, in [regulon|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528,18643936]
  • additional information

  • [protein|search|MgsR] is subject to post-translational redox-sensitive activation by intramolecular disulfide bond formation in response to ethanol stress [PubMed|22812682]
  • view in new tab

    Biological materials


  • MGNA-C476 (yqgZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24770 ([gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTTCCTCCTCA, downstream forward: _UP4_TGATGAAAAACCGAAGATCC
  • BKK24770 ([gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTTCCTCCTCA, downstream forward: _UP4_TGATGAAAAACCGAAGATCC
  • References

  • 18643936,12107147,15805528,18643936,22812682,22582280