SubtiBank SubtiBank
mgsR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mgsR

transcriptional regulator of a subset of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] general stress regulon, required for protection against oxidative stress
locus
BSU_24770
pI
9.28
mw
14.68 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
controls a subset of general stress genes
product
transcriptional regulator
essential
no
synonyms
yqgZ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,564,026 2,564,406

    The protein

    Catalyzed reaction/ biological activity

  • exerts a positive or negative effect on the expression of 53 or 18 stress genes, respectively [Pubmed|18643936]
  • Protein family

  • ArsC family (with [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and [protein|5278DD377B110CC14E239B9428F1985B472EEDF5|YusI], according to UniProt)
  • Paralogous protein(s)

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]
  • Modification

  • [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] is subject to post-translational redox-sensitive activation by intramolecular disulfide bond formation in response to ethanol stress [Pubmed|22812682]
  • phosphorylation on R17, R95 by [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB], this tags the protein for degradation by [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [pubmed|32477307,30962353]
  • Structure

  • [PDB|3L78] (from Streptococcus mutans, 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]
    description
    [Pubmed|18643936]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|18643936], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR]: activation, in [regulon|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528,18643936]
  • additional information

  • [protein|search|MgsR] is subject to post-translational redox-sensitive activation by intramolecular disulfide bond formation in response to ethanol stress [PubMed|22812682]
  • view in new tab

    additional information

  • half-life of the protein: 6 minutes [pubmed|32477307]
  • Biological materials

    Mutant

  • MGNA-C476 (yqgZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2474 NBRP B. subtilis, Japan]
  • BKE24770 ([gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTTCCTCCTCA, downstream forward: _UP4_TGATGAAAAACCGAAGATCC
  • BKK24770 ([gene|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|mgsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTTTTTTCCTCCTCA, downstream forward: _UP4_TGATGAAAAACCGAAGATCC
  • References

  • 18643936,12107147,15805528,18643936,22812682,22582280,30962353,32477307