SubtiBank SubtiBank
ykoG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykoG

two-component response regulator ([SW|OmpR family])
locus
BSU13250
pI
5.11
mw
25.86 kDa
protein length
228 aa Sequence Blast
gene length
687 bp Sequence Blast
function
unknown
product
two-component response regulator ([SW|OmpR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    1,391,953 1,392,639

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Paralogous protein(s)

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR], [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]
  • Modification

  • phosphorylated by [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|5ED4] (from Mycobacterium tuberculosis, 44% identity) [pubmed|27079268]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]-[gene|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]-[gene|0678357183072D2716B913C07103CEBF65E60D14|ykoI]-[gene|348EAFC260435B3E0ED3CC7BC27EBA8DCFCBBEDC|ykoJ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A775 (ykoG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/775 NBRP B. subtilis, Japan]
  • BKE13250 ([gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGACCATCCTCTCC, downstream forward: _UP4_GGCTATGCCATTAAGGGGTA
  • BKK13250 ([gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGACCATCCTCTCC, downstream forward: _UP4_GGCTATGCCATTAAGGGGTA
  • References

  • 10094672,23504016,27079268