SubtiBank SubtiBank


two-component response regulator ([SW|OmpR family])
25.86 kDa
protein length
228 aa Sequence Blast
gene length
687 bp Sequence Blast
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    1,391,953 1,392,639

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Paralogous protein(s)

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR], [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 5-119) (according to UniProt)
  • Modification

  • phosphorylated by [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|5ED4] (from Mycobacterium tuberculosis, 44% identity) [pubmed|27079268]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A775 (ykoG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13250 ([gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGACCATCCTCTCC, downstream forward: _UP4_GGCTATGCCATTAAGGGGTA
  • BKK13250 ([gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGACCATCCTCTCC, downstream forward: _UP4_GGCTATGCCATTAAGGGGTA
  • References

  • 10094672,23504016,27079268