SubtiBank SubtiBank
opuE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

opuE

proline transporter
locus
BSU06660
pI
9.81
mw
53.12 kDa
protein length
492 aa Sequence Blast
gene length
1479 bp Sequence Blast
function
compatible solute transport
product
proline transporter
essential
no
synonyms
yerK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.9|Uptake of compatible solutes]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    726,840 728,318

    Phenotypes of a mutant

  • strong growth disadvantage in high-salinity minimal media lacking proline [Pubmed|22685134]
  • The protein

    Protein family

  • solute:sodium symporter family (SSS family)
  • Paralogous protein(s)

  • [protein|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|PutP]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|9701821], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by glucose ([protein|search|CcpA]) [Pubmed|22900538]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • BKE06660 ([gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA, downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
  • BKK06660 ([gene|6A1F759DAC09D364602460E5467E2761E97CE45C|opuE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTTACCCTCTCTTCA, downstream forward: _UP4_TAAGCAATAAGCCATCAAGC
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

    Reviews

  • 27935846
  • Original publications

  • 12884008,9701821,11902719,11902719,22685134,22900538,22383849,24142252,22139509,26728461