SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to 3-oxoacyl- acyl-carrier protein reductase
13.34 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,377,019 3,377,408

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Structure

  • [PDB|2HQ1] (from Clostridium Thermocellum 37% identity)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials


  • MGNA-B597 (yusR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32900 ([gene|6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE|yusR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTGACGGCATACAGCT, downstream forward: _UP4_CTGTAAAGAAAGGGATGCGG
  • BKK32900 ([gene|6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE|yusR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTGACGGCATACAGCT, downstream forward: _UP4_CTGTAAAGAAAGGGATGCGG