SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor, [SW|GntR family], control of cell envelope stress responses in response to ramoplanin
14.55 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
control of cell envelope stress responses
transcriptional repressor ([SW|GntR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • Gene

    3,118,847 3,119,239

    Phenotypes of a mutant

  • non-transformable [pubmed|28189581]
  • reduced sporulation efficiency [pubmed|28189581]
  • The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 10-78) (according to UniProt)
  • Structure

  • [PDB|3NEU] (similar protein from ''Listeria innocua'', 41% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|10986249,21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • expressed early in the stationary phase [Pubmed|10986249]
  • view in new tab

    Biological materials


  • GP2641 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2647 (Δ[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A138 (ytrA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30460 ([gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT, downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
  • BKK30460 ([gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACTTCCCTACTTTCT, downstream forward: _UP4_GCTGATGTGAAGGGAGGCAA
  • References

  • 10986249,12399512,23504016,21856850,28189581