SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


54.67 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
beta-glucoside utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of beta-glucosides]
  • Gene

    4,121,166 4,122,605

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 1 family] (according to UniProt)
  • Structure

  • [PDB|2XHY] (from E. coli, 66% identity) [pubmed|22393408]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE40110 ([gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCATGTTTAATT, downstream forward: _UP4_TAAGAAGCGCTCGAATCGAG
  • BKK40110 ([gene|6A06E0E3017DB6E75D5C1114D954D51CED546051|bglA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCATGTTTAATT, downstream forward: _UP4_TAAGAAGCGCTCGAATCGAG
  • References

  • 14652714,15139916,10627040,8125345