SubtiBank SubtiBank
ydaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaJ

lipoprotein, may modify the extracellular polysaccharide synthesized by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|YdaL]-[protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM]-[protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]
locus
BSU_04270
pI
4.90
mw
40.84 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast
function
unknown
product
lipoprotein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    478,944 480,032

    The protein

    Protein family

  • glycosyl hydrolase 8 (GH8) family [Pubmed|27897378]
  • Structure

  • [PDB|3REN] (alpha-amylase from Clostridium perfringens, 25% identity) [pubmed|21905105]
  • [SW|Localization]

  • exported with N-terminal signal peptide, attached to the cell membrane (lipoprotein), faces towards the medium [Pubmed|27897378]
  • Expression and Regulation

    Operons

    genes
    [gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|22383849], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C073 (ydaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2071 NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04270 ([gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGGCAAATCCCCCTTTG, downstream forward: _UP4_CTGTTAGCCGAAAGGAAGCT
  • BKK04270 ([gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGGCAAATCCCCCTTTG, downstream forward: _UP4_CTGTTAGCCGAAAGGAAGCT
  • References

    Reviews

  • 28296273
  • Original publications

  • 22383849,27897378,21905105