SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional regulator of extracellular enzyme genes
8.50 kDa
protein length
gene length
219 bp Sequence Blast
regulation of extracellular enzyme genes
transcriptional regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    959,290 959,508

    The protein

    additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE08810 ([gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT, downstream forward: _UP4_TGACTACAACGGGTTTTTGC
  • BKK08810 ([gene|69D55899C7CE30A282AF6011527FAD55A76CDBDA|senS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAAAAAAGGCCCTTAT, downstream forward: _UP4_TGACTACAACGGGTTTTTGC
  • References

  • 1479343,2108127,16321961