SubtiBank SubtiBank
spoVK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoVK

required for spore maturation
locus
BSU_17420
pI
8.82
mw
36.52 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
spore maturation
product
unknown
essential
no
synonyms
spoVJ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,874,203 1,875,171

    The protein

    Protein family

  • cbxX/cfxQ family (single member, according to UniProt)
  • Structure

  • [PDB|3ZUH] (from Rhodobacter sphaeroides, 41% identity) [pubmed|22048315]
  • Expression and Regulation

    Operons

    genes
    [gene|69D4685E435B472A3E87E312ECA77553631687E4|spoVK]
    description
    [Pubmed|1787791]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1787791], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|1787791], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK]) [Pubmed|15699190,1787791]
  • view in new tab

    Biological materials

    Mutant

  • 1S99 ( ''spoVK''::''erm''), [Pubmed|1732196], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S99&Search=1S99 BGSC]
  • BKE17420 ([gene|69D4685E435B472A3E87E312ECA77553631687E4|spoVK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCACCTCTCTGTTCT, downstream forward: _UP4_TAGACCTCTCAGTTTTTGAG
  • BKK17420 ([gene|69D4685E435B472A3E87E312ECA77553631687E4|spoVK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCACCTCTCTGTTCT, downstream forward: _UP4_TAGACCTCTCAGTTTTTGAG
  • References

  • 1787791,1732196,2514336,15383836,22048315