SubtiBank SubtiBank
yngB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yngB

similar to UTP-glucose-1-phosphate uridylyltransferase
locus
BSU_18180
pI
5.20
mw
32.99 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • Gene

    Coordinates
    1,946,702 1,947,595

    The protein

    Catalyzed reaction/ biological activity

  • α-D-glucose 1-phosphate + H+ + UTP --> diphosphate + UDP-α-D-glucose (according to UniProt)
  • Protein family

  • UDPGP type 2 family (with [protein|D368988F85D8436DD424B0B4A1591BDF092A8EA7|GtaB] and [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA], according to UniProt)
  • Paralogous protein(s)

  • [protein|D368988F85D8436DD424B0B4A1591BDF092A8EA7|GtaB], [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA]
  • Structure

  • [PDB|5I1F] (from Burkholderia vietnamiensis, 50% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CBCBF948979D9D63CBA86A9ED865E43B1F85A0AD|yngA]-[gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]-[gene|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]
    description
    [Pubmed|20512483]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B396 (yngB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1395 NBRP B. subtilis, Japan]
  • BKE18180 ([gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCACTTTTTTTCTCATTC, downstream forward: _UP4_TAAAAAAATTGTAACCATCT
  • BKK18180 ([gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCACTTTTTTTCTCATTC, downstream forward: _UP4_TAAAAAAATTGTAACCATCT
  • References

  • 20512483