SubtiBank SubtiBank
yqkE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqkE

unknown
locus
BSU_23630
pI
9.93
mw
8.97 kDa
protein length
gene length
225 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,460,278 2,460,502

    Expression and Regulation

    Operons

    genes
    [gene|699106D961A3FF8D925EBCBD31EA5D1FC3166D5D|yqkE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE23630 ([gene|699106D961A3FF8D925EBCBD31EA5D1FC3166D5D|yqkE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGACTTCCCCCATGT, downstream forward: _UP4_TAAACCAGCACCCGTACAGG
  • BKK23630 ([gene|699106D961A3FF8D925EBCBD31EA5D1FC3166D5D|yqkE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAGACTTCCCCCATGT, downstream forward: _UP4_TAAACCAGCACCCGTACAGG