SubtiBank SubtiBank
cpaA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cpaA

K+/H+ antiporter
locus
BSU_11640
pI
5.25
mw
67.29 kDa
protein length
614 aa Sequence Blast
gene length
1845 bp Sequence Blast
function
export of potassium ions
product
K+/H+ antiporter
essential
no
synonyms
yjbQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,240,356 1,242,200

    The protein

    Protein family

  • Monovalent cation:proton antiporter 2 (CPA2) transporter (TC 2.A.37) family (with [protein|9A54C82323BA9220CAA6041E3745FAB9E222FE78|KhtU], according to UniProt)
  • [SW|Domains]

  • contains a [SW|RCK_N domain] (aa 403-525) (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
  • contains a [SW|RCK_C domain] at the C-terminus (aa 533-614) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])
  • Effectors of protein activity

  • binds c-di-AMP, which likely activates export activity [pubmed|31061098]
  • Structure

  • [PDB|4BWZ] (from Thermus thermophilus, corresponds to the transmembrane domain (aa 27 ... 402), 26% identity) [pubmed|23995679]
  • [PDB|4YS2] (S. aureus CpaA, the [SW|RCK_C domain] in complex with c-di-AMP, 58% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B163 (yjbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1162 NBRP B. subtilis, Japan]
  • GP2082 (''[gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE11640 ([gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG
  • BKK11640 ([gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG
  • Expression vectors

  • pGP2909 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2438 ''yjbQ-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 31361596
  • Original publications

  • 26171638,23995679,31061098