SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


3-hydroxy-1-pyrroline-5-carboxylate dehydrogenase
56.15 kDa
protein length
515 aa Sequence Blast
gene length
1548 bp Sequence Blast
arginine, ornithine and citrulline utilization
3-hydroxy-1-pyrroline-5-carboxylate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,878,966 3,880,513

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamate 5-semialdehyde + NAD+ --> 2 H+ + L-glutamate + NADH (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS]
  • Modification

  • phosphorylation on (Thr-2 OR Thr-4 OR Tyr-5) [Pubmed|17218307]
  • Structure

  • [PDB|3RJL] (1-pyrroline-5-carboxylate dehydrogenase from ''Bacillus licheniformis'', 68% identity, 88% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|8113162], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|8113162], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7565595], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • additional information

  • expression of the ''[protein|search|rocA]-[protein|search|rocB]-[protein|search|rocC]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [ Reference]
  • view in new tab

    Biological materials


  • BKE37780 ([gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTAGTCCCCCTCGTG, downstream forward: _UP4_TGATTTGAGAGAAATAAAAT
  • BKK37780 ([gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTAGTCCCCCTCGTG, downstream forward: _UP4_TGATTTGAGAGAAATAAAAT
  • References

  • 7565595,12618455,8113162,17218307,20817675