SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


transcription repressor of [gene|18506FB74F6BB9278F22EB7DCDA3CF72575CC32A|copZ]-[gene|727024F7B1AC19676ED4B516CF46A47B1328310B|copA]
11.34 kDa
protein length
101 aa Sequence Blast
gene length
306 bp Sequence Blast
control of copper homeostasis
transcription repressor

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Copper]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,443,896 3,444,201

    The protein

    Protein family

  • CsoR family (single member, according to UniProt)
  • Effectors of protein activity

  • Cu(I) ions cause release of CsoR from its operator sites
  • Structure

  • [PDB|4M1P] (from Geobacillus thermodenitrificans, 59% identity) [pubmed|24831014]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B604 (yvgZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33520 ([gene|6977F18870004AD236539D9409255815E6BE9241|csoR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGTACACCTCTGTTTA, downstream forward: _UP4_TAAAGCGTTTTTTATTGTAA
  • BKK33520 ([gene|6977F18870004AD236539D9409255815E6BE9241|csoR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGTACACCTCTGTTTA, downstream forward: _UP4_TAAAGCGTTTTTTATTGTAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References


  • 22918892,25209494
  • Original publications

  • 18048925,19168619,20233928,19168619,19249860,24831014