SubtiBank SubtiBank
ytcC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytcC

sporulation protein, similar to lipopolysaccharide N-acetylglucosaminyltransferase
locus
BSU_30880
pI
9.59
mw
46.00 kDa
protein length
407 aa Sequence Blast
gene length
1224 bp Sequence Blast
function
lipopolysaccharide biosynthesis
product
sporulation protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    3,157,961 3,159,184

    The protein

    Protein family

  • [SW|glycosyltransferase 1 family] (according to UniProt)
  • [SW|Glycosyltransferase 4 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2C17028E7DC755FFC190397AC6509E383C4DF99A|CotSA]
  • Expression and Regulation

    Operons

    genes
    [gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]-[gene|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB]-[gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849,15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC], [SW|GerE]) [Pubmed|26577401,15699190,12480901]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-A278 (ytcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/278 NBRP B. subtilis, Japan]
  • BKE30880 ([gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATTCCCCCTGATA, downstream forward: _UP4_TAAAACCTACAGCTCGTGTT
  • BKK30880 ([gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATTCCCCCTGATA, downstream forward: _UP4_TAAAACCTACAGCTCGTGTT
  • References

  • 15699190,12480901,26577401