SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation protein, similar to lipopolysaccharide N-acetylglucosaminyltransferase
46.00 kDa
protein length
407 aa Sequence Blast
gene length
1224 bp Sequence Blast
lipopolysaccharide biosynthesis
sporulation protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    3,157,961 3,159,184

    The protein

    Protein family

  • [SW|glycosyltransferase 1 family] (according to UniProt)
  • [SW|Glycosyltransferase 4 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2C17028E7DC755FFC190397AC6509E383C4DF99A|CotSA]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|22383849,15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC], [SW|GerE]) [Pubmed|26577401,15699190,12480901]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-A278 (ytcC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30880 ([gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATTCCCCCTGATA, downstream forward: _UP4_TAAAACCTACAGCTCGTGTT
  • BKK30880 ([gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTATTCCCCCTGATA, downstream forward: _UP4_TAAAACCTACAGCTCGTGTT
  • References

  • 15699190,12480901,26577401