SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphotransferase, attaches teichoic acid, teichuronic acid, or acidic capsular polysaccharide to cell wall peptidoglycan via phosphodiester linkage to N-acteylmuramic acid
35.65 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
transfer of anionic cell wall polymers from lipid-linked precursors to peptidoglycan
phosphotransferase, responsible for attachment of anionic polymers to peptidoglycan

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Export of anionic polymers and attachment to peptidoglycan]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,694,239 3,695,207

    Phenotypes of a mutant

  • a ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]'' mutant has no phenoype, the triple ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT] [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] [gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant is unable to grow under normal conditions [Pubmed|21964069]
  • The protein

    Protein family

  • LytR/CpsA/Psr (LCP) family (with [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU] and [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|TagV], according to UniProt) [Pubmed|19099556]
  • Paralogous protein(s)

  • [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|TagV], [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU]
  • [SW|Cofactors]

  • Mg2+ [Pubmed|29107701,21964069]
  • Structure

  • [PDB|6UF5] (aa 46-322) [pubmed|31969390]
  • [PDB|3MEJ]
  • [PDB|4DE9] [Pubmed|22432711]
  • [PDB|6MPS] (bound to LIIa-WTA] [Pubmed|29402087]
  • [PDB|6MPT] (bound to LI-WTA] [Pubmed|29402087]
  • [SW|Localization]

  • cytoplasmic membrane (with extracytoplasmic catalaytic domain) [Pubmed|21964069]
  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed at high salt concentrations ([protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]) [pubmed|18179421]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • expressed at high salt concentrations ([protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]) [pubmed|18179421]
  • view in new tab

    Biological materials


  • MGNA-A547 (ywtF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35840 ([gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCAATACCTCACGT, downstream forward: _UP4_TAATGAACGGGATGGCGATT
  • BKK35840 ([gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCAATACCTCACGT, downstream forward: _UP4_TAATGAACGGGATGGCGATT
  • References


  • 24024634
  • Original publications

  • 18957862,9353933,18179421,19099556,21964069,22432711,29107701,29402087,31969390