SubtiBank SubtiBank
mrgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mrgA

iron storage protein, DNA-binding stress protein, forms highly stable, multimeric protein-DNA complexes which protect against oxidative killing
locus
BSU32990
pI
4.60
mw
17.19 kDa
protein length
153 aa Sequence Blast
gene length
462 bp Sequence Blast
function
iron storage,
product
mini-ferritin, DNA-binding stress protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,383,565 3,384,026

    The protein

    Catalyzed reaction/ biological activity

  • forms highly stable, multimeric protein-DNA complexes which protect against oxidative killing
  • Protein family

  • dps family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|11D04B31B4BF223E276077EC16BBDA566694CBF6|Dps]
  • [SW|Cofactors]

  • contains an iron-sulfur cluster
  • Structure

  • [PDB|2CHP] [pubmed|16893214]
  • Expression and Regulation

    Operons

    genes
    [gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]-[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
    description
    [Pubmed|8396117]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14563870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE32990 ([gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATAACGTCCTCCTT, downstream forward: _UP4_TAACAAAAAAGCTGAACCTT
  • BKK32990 ([gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATAACGTCCTCCTT, downstream forward: _UP4_TAACAAAAAAGCTGAACCTT
  • References

    Reviews

  • 15222465
  • Original publications

  • 9393687,14563870,7667267,12486061,8396117,9393707,8709848,8932315,11532148,16893214