SubtiBank SubtiBank
mrgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mrgA

iron storage protein, DNA-binding stress protein, forms highly stable, multimeric protein-DNA complexes which protect against oxidative killing
locus
BSU_32990
pI
4.60
mw
17.19 kDa
protein length
153 aa Sequence Blast
gene length
462 bp Sequence Blast
function
iron storage,
product
mini-ferritin, DNA-binding stress protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,383,565 3,384,026

    The protein

    Catalyzed reaction/ biological activity

  • forms highly stable, multimeric protein-DNA complexes which protect against oxidative killing
  • Protein family

  • dps family (with [protein|11D04B31B4BF223E276077EC16BBDA566694CBF6|Dps], according to UniProt)
  • Paralogous protein(s)

  • [protein|11D04B31B4BF223E276077EC16BBDA566694CBF6|Dps]
  • [SW|Cofactors]

  • contains an iron-sulfur cluster
  • Structure

  • [PDB|2CHP] [pubmed|16893214]
  • Expression and Regulation

    Operons

    genes
    [gene|D945CAD7209CB94A7B9E23263476124B7E8853DD|yusZ]-[gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]
    description
    [Pubmed|8396117]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14563870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE32990 ([gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATAACGTCCTCCTT, downstream forward: _UP4_TAACAAAAAAGCTGAACCTT
  • BKK32990 ([gene|68EFECAC6B771D7BDCCD7FD30511152EDEFCEE5B|mrgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATAACGTCCTCCTT, downstream forward: _UP4_TAACAAAAAAGCTGAACCTT
  • References

    Reviews

  • 15222465
  • Original publications

  • 9393687,14563870,7667267,12486061,8396117,9393707,8709848,8932315,11532148,16893214