SubtiBank SubtiBank
ydgB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydgB

unknown
locus
BSU_05570
pI
3.49
mw
9.32 kDa
protein length
gene length
273 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    602,441 602,713

    Expression and Regulation

    Operons

    genes
    [gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]-[gene|483587EB658850D786C3C95C02D419994FCC9F45|ydgA]-[gene|8F85E6DE353F29759301A463335BFC15F829E2D0|cotP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|9068633], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC]) [Pubmed|15699190]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-C173 (ydgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2171 NBRP B. subtilis, Japan]
  • BKE05570 ([gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACACCCTTCCA, downstream forward: _UP4_ATTTTAGATTAAAGGGGTTT
  • BKK05570 ([gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACACCCTTCCA, downstream forward: _UP4_ATTTTAGATTAAAGGGGTTT
  • References

  • 15699190,9068633,11150673