SubtiBank SubtiBank
malR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

malR

two-component response regulator, regulation of malate uptake
locus
BSU31530
pI
5.98
mw
26.82 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
regulation of malate uptake
product
two-component response regulator
essential
no
synonyms
yufM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    3,238,751 3,239,458

    Phenotypes of a mutant

  • unable to use malate as the single carbon source [Pubmed|12949159]
  • The protein

    Modification

  • phosphorylated by [protein|6FBBC2BDEAD72BEA0D9EA56668FDA5A3BE6F694E|MalK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|5LWK] (from Lactobacillus paracasei, N-terminal part, corresponds to aa 1 ... 122, 43% identity) [pubmed|28577341]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]
    description
    [Pubmed|9274030]
    view in new tab

    genes
    [gene|6FBBC2BDEAD72BEA0D9EA56668FDA5A3BE6F694E|malK]-[gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A635 (yufM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/635 NBRP B. subtilis, Japan]
  • GP1301 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE31530 ([gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATGATTTTCCTC, downstream forward: _UP4_TAAGAAAACGCACTGCTTGC
  • BKK31530 ([gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATGATTTTCCTC, downstream forward: _UP4_TAAGAAAACGCACTGCTTGC
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 10094672,12949160,12949159,9274030,28577341