SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component response regulator, regulation of malate uptake
26.82 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
regulation of malate uptake
two-component response regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,238,751 3,239,458

    Phenotypes of a mutant

  • unable to use malate as the single carbon source [Pubmed|12949159]
  • The protein


  • [SW|Response regulatory domain] (aa 3-119) (according to UniProt)
  • Modification

  • phosphorylated by [protein|6FBBC2BDEAD72BEA0D9EA56668FDA5A3BE6F694E|MalK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|5LWK] (from Lactobacillus paracasei, N-terminal part, corresponds to aa 1 ... 122, 43% identity) [pubmed|28577341]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A635 (yufM::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1301 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE31530 ([gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATGATTTTCCTC, downstream forward: _UP4_TAAGAAAACGCACTGCTTGC
  • BKK31530 ([gene|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|malR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATGATTTTCCTC, downstream forward: _UP4_TAAGAAAACGCACTGCTTGC
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 10094672,12949160,12949159,9274030,28577341